Star Trek – The Next Generation

“A Message from Timbor”

by William Sofer

© February 22, 1993

Space.…The final frontier…

These are the voyages of the Star Ship Enterprise. It’s continuing mission…

Captain Picard: Star Date 2456.55. We are on assignment in the beta quadrant to investigate reports of the sudden appearance of an unknown life form on the surface of Timbor 11, a planet that was long thought to be uninhabited.

Data, First Officer William Riker and Counselor Troi are having a conversation around a table in 10-Forward. Riker is sipping a Salucian Punch, a process that is made somewhat more difficult by the presence of a snail-like creature – a Yimbee – on the rim of his glass. Riker is waiting for it to move along before he takes his next drink. The others are watching with much interest. He is describing what it going on.

Commander Riker: As the Yimbee moves around the glass, it leaves behind a tiny layer of slime. If you’re quick, and you take a sip from an area just after it’s moved, and if the slime hasn’t completely evaporated, a little gets dissolved in the juice. Its taste is sublime, a combination of coconut and guava and Tobaluzian resk root.… Some people say there’s a little bit of aphrodisiac in it. [He glances invitingly at Troi].

Data: There are 127 known drinks in which a substance is applied to the rim of a drinking container before it is imbibed. However, only 8 involve secretions by a living animal. And of these, only 2 are drunk while the creature is in or on the vessel. It is clear, Commander, that you are participating in an unusual exercise which, no doubt, is contributing to your enjoyment of the process.

Commander Riker: [Ignoring Data’s remarks] You have to keep pretty close watch out for the Yimbee though. If you get too close to it, it can turn around in a flash and give you a serious bite on the lip.

Counselor Troi: Will, I’m going to give you a serious bite on the lip if you don’t pay more attention to your work. What progress have you made in analyzing the creatures on Timbor?

Commander Riker: Not too much, but we have finished a long range scan of the surface. The planet is crawling with them. They’re little scrawny things covered with a coarse hair with , as far as we could judge, a very primitive locomotion. They slowly roll from place to place. They don’t appear to have eyes, or ears – or much of anything else. They just sit out in the suns, and roll about while collecting energy in some way. And of course they’re continually multiplying – they’re particularly talented at that. Very strange.

Counselor Troi: They don’t seem particularly unusual. There must be many planets in which life hasn’t evolved sufficiently to produce sophisticated organisms. Isn’t that right Data?

Data: You are correct, Counselor. About 97% of all known planets showing any life forms on them at all are occupied by organisms that are considered primitive. [Looking at Riker’s glass] Creatures with the intelligence of a Yimbee, or less.

Commander Riker: What is unusual is not the creatures themselves, or even that they haven’t evolved very far, but the fact that they are the only living things on the planet. As far as we can tell from our scans, there are no predators, no parasites, no plants. Just these simple creatures. Data, do you know of any other instance where a planet is occupied by only a single life form?

Data: [Pauses to access memory] No, Commander. According to the eight laws of Ecology propounded one hundred and twenty one years ago by Professor Yoorgay Loo of HunSang University, it is impossible for life to have developed to produce only a single kind of living thing. It is an ecologically unstable situation. Only one apparent exception is known.

Riker: And what is that?

Data: About 20 years ago, INKarian Corn was found growing on Foorsoll 3 in the Xerbas system. At the time of its discovery, it was the only living thing on the planet. However, later analysis revealed that the Cardassians had sown the planet with sterilized seed, and were using the planet to grow the crop in great abundance. However, after a short time they abandoned the project because the corn quickly denuded the soil and atmosphere of needed nutrients, and the corn stopped growing well.

Riker: That’s intriguing – the only exception to Loo’s laws was an artificial creation. I wonder if that means that the creatures on Timbor were placed there by some beings who are raising them for food.

Data: That would seem very unlikely Commander. As you yourself have pointed out, the creatures are mostly hair. There appears to be very little in the way of edible matter on them.

Riker: [Carefully finishing his drink] Well it’s strange. And because it is so peculiar, we’re certainly not going to do is risk taking any of these creatures aboard the Enterprise. [Getting up from his chair and leaving]. But we do need to take a closer look at them. Beverly, Worf, and I are going to beam down to the surface of Timbor at 18:00 hours to do some further analysis.

The scene is on the surface of Timbor. Lieutenant Worf, Dr. Beverly Crusher and Commander Riker are in the process of beaming down . Worf and Riker have their phasers drawn. Beverly is carrying a large case evidently filled with biological instrumentation. Timbor orbits two suns, so the light is very bright and yellow. They are standing on a featureless plane surrounded by hundreds of the creatures that occupy the planet. All are identical. They slowly roll from place to place and seem not to recognize the existence of the crew members. In no apparent danger, the crew reholsters their weapons. Dr. Crusher opens the case and removes a portable analyzer.

Dr. Crusher: I want to do a behavioral and physiological analysis on these creatures. Worf, please catch one, and I’ll examine it. Be careful, they may be dangerous.

Worf: I am setting my phaser on its lowest setting, Doctor. [He shoots one of the creatures. It immediately stops moving and turns a grayish color. He goes over to it and gently lifts it and hands it to Dr. Crusher.]

Dr. Crusher places the creature on a plastic sheet and begins examining it. After a few seconds, she removes a scanner from her bag, a pointed instrument that detects living things, and uses it to probe the creature. She is obviously upset.

Dr. Crusher: It’s dead. Apparently, the phaser caused some damage to its primitive nervous system. [glancing around] They don’t seem hostile. Let’s take a chance and capture one without stunning it. Worf?

Mr. Worf approaches one of the creatures as it rolls along. It makes no effort to escape. He gently takes it in his hands and lifts it up. It stops moving instantly, turning gray in the process. He presents the creature to Dr. Crusher.

Dr. Crusher: [She examines the Timborian. This time she takes out the scanner immediately. Again, a frown crosses her face] This one’s dead too. I’ve never seen anything like this. They seem extremely fragile.

Riker: Let me see. [Riker goes over to another of the great number of creatures that are wandering around, and pokes one gently with his index finger. It rolls over, stops moving, and turns gray. He hands the Timborian over to Dr. Crusher, who scans it and indicates that it too is dead].

With the death of the third creature, the others stop moving around purposelessly. Instead, from all over, they begin to slowly advance on the three members of the Enterprise crew. One succeeds in touching Worf, and, as soon as it does so, it stops moving and turns gray. Another does the same thing to Dr. Crusher.

Riker: [Touches his communicator.] Riker to Enterprise. We’re being attacked by the Timborians. Beam us out of here… now!

The crew members beam up.

The major officers are gathered together in the conference room. Captain Picard, First Officer Riker, Data, Lieutenant Worf, Counselor Troi, and Dr. Crusher, are discussing the events of the day on Timbor.

Picard: Have any of you [glancing at Crusher, Riker and Worf] suffered any ill effects from your experience?

Dr. Crusher: I’ve checked us all thoroughly. None of us show any signs of infection or illness. The fact is that I don’t see any way that the Timborians could hurt us. From what I was able to observe, they don’t have any teeth or horns or hoofs or anything else that could inflict any damage . In fact, they seem utterly defenseless. But if that is so, why did they attack us?

Picard: It is definitely a puzzle. What do you suggest that we do next?

Dr. Crusher: Ordinarily, I would take a tissue sample and do a DNA scan on the creatures. In all known carbon based life forms in the universe, the DNA contains all of the instructions that make an organism work. A DNA scan would tell us how complex it is, whether it is truly defenseless, and what kind of other organisms it is related to. But [shaking her head] I’m not sure how to proceed. If we were to go down onto the planet again and pick up a creature, we would surely kill it. And, of course, that is against the Prime Directive. Even though the Timborians seem primitive, they are sentient organisms. We can’t go around and simply kill them. On the other hand, if we were to beam one up, that might kill it too. And if it doesn’t die, it might as soon as I took a sample for analysis.

Troi: I have an idea. Let’s suppose that the reason that they die is that they can’t tolerate contact with another life form. That would explain why there’s only one kind of living thing on the planet. If that’s true, then if we send down a robot, we could get a DNA sample without any of the crew actually handling any of them.

Data: Might I suggest a simpler solution. At least five Timborians were killed during the away team’s mission. Since they are already dead, it would not be unethical to assay their DNA.

Picard: I think that Data is right. We can scan the site where the away team set down, wait until the Timborians vacate the premises, and then beam down and secure one or more dead ones. [Glancing at Riker] Number 1, make it so.

Riker: Yes sir. [exits]

Picard: I want to consider another point now. We are all aware that a planet containing only a single life form is very unusual, if not unique. I would appreciate if some of you might offer a hypothesis concerning the origin of the beings on this planet.

Data: Natural systems are diverse. The Timborians are not. Therefore, the most likely explanation is that the occupants of Timbor were placed there some time ago by some being or beings of higher intelligence. If you accept that hypothesis, I can calculate the approximate time that the event took place. [He pauses to calculate] 57 years. This assumes that a single organism was placed on the planet; that it reproduced at the rate that we have observed; and that the number of creatures that we saw when we beamed down is representative of the total population.

Picard: But why would an intelligent being seed the planet with there creatures? What could have been their purpose?

Troi: It’s possible that the whole thing occurred by accident. A ship carrying some of these creatures could have crashed on the planet and released them inadvertently. There are many instances of such “accidentals” &endash; organisms that are carried to a new environment. They are free from predators and reproduce wildly. You may remember the scourge of rabbits in Australia on twentieth century earth, or the plague of simelwhats on Blythsome 5 in the 23rd century.

Picard: You might be correct Counselor. We may never know the answer, but perhaps we will get some clues from a DNA scan. [The conversation is interrupted by Picard’s communicator. He touches it.]

Picard here.

LaForge: Captain, we have a problem. For some reason, our orbit around Timbor is unstable. We’ve slowly being pulled down to the surface. I’ve had to steadily increase power over the last few hours in order to maintain our position. In the last few minutes, it’s gotten much worse.

Picard: Are we in any danger?

LaForge: It sure looks that way. Right now our impulse engines are just able to balance the pull of the planet. But it’s a strain on them. If they overheat, we’re going to fall into the atmosphere.

Picard: How much time do we have?

LaForge: Not much. A couple of hours at best.

Two hours have gone by. The scene is Dr. Crusher’s laboratory. A dead Timborian is on her operating table, surrounded by a power grid. Over the body is a DNA scanner. It is taking readings that are displayed on a monitor. Dr. Crusher, Captain Picard and Lt. Worf are looking at the data as it scrolls by.

Dr. Crusher: This is really amazing. I’ve never seen anything like it before.

Picard: Forgive me Doctor, but you’ll have to forgive my ignorance. I took molecular genetics more than 20 years ago. And it was my weakest subject. Why do you find this DNA sequence so astonishing? It looks quite ordinary to me.

Dr. Crusher: Let me refresh your memory Jean-Luc. You may recall that DNA consists of a very long set of instructions written in an alphabet of four letters – A, C, G, and T.

Worf :That’s what I see in the Timborian’s DNA.

Dr. Crusher: You’re right, Worf. It isn’t unusual at all in that way. but let me finish. The instructions in the DNA are in a code that is the same for all DNA-based life in the universe. You read this language by taking the DNA three letters at a time and translating it according to a table that’s stored in the computer.

Picard: Ah yes, the famous genetic code that I spent so many hours memorizing at the Academy. As I recall, the result is another long string of letters, an amino acid sequence.

Dr. Crusher: Right! The ‘purpose’ of DNA is to encode a sequence of amino acids. These are assembled in the order that they’re read off of the DNA into a molecular machine called a protein. Tens of thousands of different proteins are made by organisms and together they carry out all the reactions of living things.

Worf: Very interesting Doctor, but I still don’t get why Timborian DNA is peculiar. Doesn’t it code for proteins?

Dr. Crusher: Yes it does. But the proteins are very remarkable. You may recall that in the 22nd century, the scientific community got together and sequenced the DNA of all known organisms. Our computer has all that information in its memory banks. Since the DNA can be translated into protein sequences, that means that we also have access to the sequence of all known proteins.

Picard: I see. And the proteins of the Timborians are different from that of any other organism?

Dr. Crusher: No! That’s what’s fascinating. The Timborians appear to be made up of proteins that come from hundreds of previously known species. Look at this one here [points to screen]. It is the exact sequence of RNA polymerase from a Discinian rat-hog. And this is an amino acid-tRNA synthetase just like that from a Carpacian slewn. It looks like someone or something has assembled Timborians from the parts of other species.

Picard: That seems consistent with the idea that Timborians have been assembled by an intelligent being.

Dr. Crusher: There’s no getting around it now. And there’s something more. There is one long DNA sequence that is different from all the others. [addressing the computer]

Computer, display DNA sequence alpha-G-delta. [the screen shows the sequence of part of a DNA as follows:

ATGTACTAGAATGCTATGGAATAGATTTCTTAGTTTGCTCGTTCTTAG …

and its corresponding protein sequence:

met tyr end asn ala met glu end ile ser end leu ala arg ser …

This sequence makes absolutely no sense. There’s no protein in the universe like it. In fact, this sequence of amino acids couldn’t form a protein.

Captain Picard’s communicator signals. He touches the device.

Picard: Picard here.

Riker: Captain. There’s been a new development on Timbor. You’d better come up to the bridge.

Picard: On my way, number 1. [Aside to Dr. Crusher] Beverly, see if you can make some sense of that amino acid sequence. I have a feeling that it’s telling us something important.

Picard is on the bridge and is conversing with Riker while they are viewing the planet on their giant monitor.

Riker: You can see that they’re all dying.

Picard: When did you begin to notice?

Riker: About 15 minutes ago. First a few turned gray at about the spot that we landed. And soon many more started dropping. It looks like the entire planet will be engulfed and within a half hour all the Timborians will be dead.

Commercial 2

Picard, Dr. Crusher, Data and Troi are in the Dr. Crusher’s laboratory. Several other Timborian bodies are stacked up for analysis. Picard is feeling guilty at the destruction that they’ve caused.

Picard: How could we have caused such a disaster?

Dr. Crusher: We might not have. At least not directly. At first, I thought that we introduced some destructive micro-organism onto Timbor when we beamed down. But that is obviously not the case. The Timborians are dying from some sort of self inflicted disease that is set off by some signal that is encoded in their DNA. Apparently, whoever &endash; or whatever &endash; created the organisms set them up so that they would all die if someone landed on the planet and started to examine the inhabitants.

Picard: I see. That peculiar DNA and protein sequence that you showed us is part of a trigger that makes the creatures die.

Dr. Crusher: No. At least I don’t think so. The trigger that we set off is in another section of the DNA. I still don’t know what the DNA that I showed you does.

Picard: [communicator sounds] Picard here.

LaForge’s voice: Captain, the impulse engines can’t last too much longer. I diverted the cooling fluid to the engines to try to keep them from overheating. That will work for a while, but if we’re going to escape, we’re going to have to figure out what’s dragging us to the surface. And fast.

Picard: Alright Giordi. [Turning to the crew]. I’m afraid that we’re going to have to postpone our analysis of the Timborians and concentrate on more pressing problems. [turns to Data] Data, have you been able to find out anything about what may be attracting us to the surface?

Data: I have made some modest progress Captain. There are no verified records of any previous vessels orbiting Timbor. There are also few indications of a ship trapped in an attractive field as we are. But there is one event that occurred precisely 57 years ago that may be relevant. A distress signal was picked up at Parness beta, a space station some 30 parsecs from here. It indicated that a science research vessel, the Willier, was trapped in a gravity well of some kind. It proved impossible to trace the origin of the signal, and the Willier was never heard from again.

Picard: Who was on the Willier?

Data: It carried a full complement of genetic engineering specialists.

Dr. Crusher: Data, I’ll bet that you have thought of some explanation for all of this.

Data: You are correct Doctor, but I do not feel that is necessary to wager anything. I have developed a hypothesis. Let us assume that a ship of genetic engineers were trapped by the same phenomenon that we face. They send off a distress signal, but before they have time to indicate their position, their ship crashed on the surface of Timbor. Further assume that some of the crew survived, but that their communication equipment was damaged.

Picard: I see. They’re in an obscure corner of the galaxy and they don’t know how long it may be before anyone will come to rescue them.

Data: Yes Captain. So they decide to leave a message that has the capability of lasting a long time. Perhaps a very long time.

Troi: They encode the message in a living organism!

Data: You are correct, Counselor. Since they are genetic engineers, and life is self renewing, they decide to place the message in the DNA of an organism that they have designed. Their idea is that the organisms will continue to reproduce until they encounter intelligent beings.

Picard: That might explain why the Timborians die as soon as they are examined. They are designed to give up their lives so that they can be analyzed.

Data: That is what I hypothesize, as well Captain.

Picard: It would also explain why all the proteins of the Timborians are exact copies of proteins from other species. The genetic engineers would have access to that information. and would have used it to design a new organism.

Data: Yes. All of the facts are consistent. The only problem with the hypothesis is that if we are right there should be a message in the Timborian’s DNA. But to date, we have been unable to decode that message.

Picard: [responding to communicator] Picard here.

LaForge’s voice: Captain, the impulse engines are about to blow. We have less than 10 minutes to reverse the pull on us by the planet.

Picard: Understood. [turns communicator off, and addresses group]. It appears that our best chance of getting out of this situation is to concentrate on decoding the message in the Timborian DNA. Any ideas?

Dr. Crusher: I’ve tried all sorts of things, but there are too many possibilities. Amino acids come in all sizes and shapes, and any of their properties could be used to establish a code.

Picard: Perhaps we’re trying to be too sophisticated. If I recall correctly, each amino acid is designated by a three letter name.

Dr. Crusher: Yes, they’re on the screen now. But I don’t see how that helps.

Picard: As I recall, there was also a one letter designation for each of the amino acids. It derived from the old days when computer memory was limited.

Dr. Crusher: Yes Jean-Luc. You’re right. I’d forgotten about the one letter names for the amino acids. Computer, display the sequence that we were examining earlier using the three letter names for the amino acids.

met tyr end asn ala met glu end ile ser end leu ala arg ser end…

Substitute the one letter names for the amino acids for the three letter designations and read off the message.

The screen goes blank for an instant, and an understandable message appears. The computer reads:

“My*name*is*Lars*i*am*the*head*of*a*science*team that*crashed*ahn*this*planet* ….”

The asterisks represent termination codes, and the peculiar spelling comes from the fact that there are only twenty amino acids, and some letters had to be left out. So there are no b’s, j’s, o’s, u’s, x’s or z’s available.

Commercial 3

Captain Picard and Doctor Crusher are conversing in his ready room. Obviously, the message that the genetic engineers left in the DNA of the organisms that they created helped the Enterprise work its way out of the gravitational field.

Dr. Crusher: Apparently only about six scientists survived the crash. It’s touching that they didn’t divert all their energies toward making their final days comfortable on the planet. Instead, they worked very hard to leave a message to warn future generations of its dangers,

Picard: Yes Beverly. It is gratifying that most intelligent beings in the universe have a strong unselfish streak in them. It reaffirms my faith in our mission.

Dr. Crusher: They won’t be forgotten. With the instructions that the engineers left us, we’ve been able to revive a few of the Timborians. They’re really quite remarkable artificial organisms. I’ve placed some in the school room. They’ll make cute pets for the children.

Scroll Credits Roll